ID: 1114250439_1114250443

View in Genome Browser

Spacer: 6

Left Crispr Right Crispr
Crispr ID 1114250439 1114250443
Species Human (GRCh38) Human (GRCh38)
Location 14:20955485-20955507 14:20955514-20955536
Sequence CCAGAACAACCAGCTGGATCAGT AGGAGCTACAGCGCGGAGACTGG
Strand - +
Off-target summary {0: 2, 1: 1, 2: 2, 3: 5, 4: 91} {0: 1, 1: 0, 2: 0, 3: 10, 4: 69}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!