ID: 1114265753_1114265764

View in Genome Browser

Spacer: -4

Left Crispr Right Crispr
Crispr ID 1114265753 1114265764
Species Human (GRCh38) Human (GRCh38)
Location 14:21071600-21071622 14:21071619-21071641
Sequence CCCAGACCCCTCCTCCCCTCCTG CCTGCCGCGGCCGTTTCCTGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 8, 3: 102, 4: 890} {0: 1, 1: 0, 2: 0, 3: 16, 4: 94}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!