ID: 1114267467_1114267480

View in Genome Browser

Spacer: 10

Left Crispr Right Crispr
Crispr ID 1114267467 1114267480
Species Human (GRCh38) Human (GRCh38)
Location 14:21081466-21081488 14:21081499-21081521
Sequence CCTTACCCTTTCTCTCCCATCCC GACTTCGTAGGCACATGAATGGG
Strand - +
Off-target summary {0: 1, 1: 2, 2: 8, 3: 190, 4: 1736} {0: 1, 1: 0, 2: 0, 3: 6, 4: 52}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!