|
Left Crispr |
Right Crispr |
| Crispr ID |
1114302462 |
1114302470 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
14:21390652-21390674
|
14:21390692-21390714
|
| Sequence |
CCTGTAATCCCAGCTACTCAGGA |
TGCTTGAACCCGGCGGGCGGAGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 53511, 1: 140483, 2: 228049, 3: 201895, 4: 144651} |
{0: 3, 1: 127, 2: 6331, 3: 40070, 4: 105709} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|