|
Left Crispr |
Right Crispr |
Crispr ID |
1114302464 |
1114302470 |
Species |
Human (GRCh38) |
Human (GRCh38) |
Location |
14:21390660-21390682
|
14:21390692-21390714
|
Sequence |
CCCAGCTACTCAGGAGGCTGATG |
TGCTTGAACCCGGCGGGCGGAGG |
Strand |
- |
+ |
Off-target summary |
{0: 683, 1: 103726, 2: 209507, 3: 242999, 4: 150565} |
{0: 3, 1: 127, 2: 6331, 3: 40070, 4: 105709} |
Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
No off target data available for this pair!
|