ID: 1114315942_1114315945

View in Genome Browser

Spacer: 5

Left Crispr Right Crispr
Crispr ID 1114315942 1114315945
Species Human (GRCh38) Human (GRCh38)
Location 14:21510194-21510216 14:21510222-21510244
Sequence CCTTATTTTTGTCTAATTAGACC ACACTGTAGATACTCAAGAAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 14, 4: 196} {0: 1, 1: 0, 2: 0, 3: 27, 4: 230}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!