ID: 1114315942_1114315948

View in Genome Browser

Spacer: 21

Left Crispr Right Crispr
Crispr ID 1114315942 1114315948
Species Human (GRCh38) Human (GRCh38)
Location 14:21510194-21510216 14:21510238-21510260
Sequence CCTTATTTTTGTCTAATTAGACC AGAAAGGTAATTAATTAGGTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 14, 4: 196} {0: 1, 1: 0, 2: 0, 3: 26, 4: 333}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!