ID: 1114344484_1114344495

View in Genome Browser

Spacer: 8

Left Crispr Right Crispr
Crispr ID 1114344484 1114344495
Species Human (GRCh38) Human (GRCh38)
Location 14:21780951-21780973 14:21780982-21781004
Sequence CCCCCTCTGGACTTTGGGTACTG GGGAAGGAGGCTTGGAGTAGGGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 1, 3: 69, 4: 728}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!