ID: 1114344743_1114344748

View in Genome Browser

Spacer: 22

Left Crispr Right Crispr
Crispr ID 1114344743 1114344748
Species Human (GRCh38) Human (GRCh38)
Location 14:21782546-21782568 14:21782591-21782613
Sequence CCAGTTCTTCTGTTTTGCCCATC GTTTTGCTCTGAGATAGATCAGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 2, 3: 45, 4: 348} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!