ID: 1114408468_1114408473

View in Genome Browser

Spacer: -3

Left Crispr Right Crispr
Crispr ID 1114408468 1114408473
Species Human (GRCh38) Human (GRCh38)
Location 14:22478341-22478363 14:22478361-22478383
Sequence CCAGAGCTAAAAGCTTTTCAGTG GTGAGGGGATTATGTCTAGAGGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 0, 3: 6, 4: 148}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!