ID: 1114409344_1114409353

View in Genome Browser

Spacer: 12

Left Crispr Right Crispr
Crispr ID 1114409344 1114409353
Species Human (GRCh38) Human (GRCh38)
Location 14:22486113-22486135 14:22486148-22486170
Sequence CCTCACAGACCCAGGCCCCTTTG CTCCCCAGAATTAAAAGAGGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 24, 4: 280} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!