ID: 1114436648_1114436656

View in Genome Browser

Spacer: 14

Left Crispr Right Crispr
Crispr ID 1114436648 1114436656
Species Human (GRCh38) Human (GRCh38)
Location 14:22712454-22712476 14:22712491-22712513
Sequence CCTCCTGTGATGTTAATATCCAG ATATTACTCCCAGTAATGCAAGG
Strand - +
Off-target summary No data {0: 1, 1: 10, 2: 161, 3: 645, 4: 1385}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!