ID: 1114462977_1114462985

View in Genome Browser

Spacer: 7

Left Crispr Right Crispr
Crispr ID 1114462977 1114462985
Species Human (GRCh38) Human (GRCh38)
Location 14:22900007-22900029 14:22900037-22900059
Sequence CCCACCCCCTTATTATTAAGGCA GTGCACCTTCCCTTTCACAGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 139} {0: 1, 1: 0, 2: 2, 3: 19, 4: 179}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!