ID: 1114470375_1114470378

View in Genome Browser

Spacer: 1

Left Crispr Right Crispr
Crispr ID 1114470375 1114470378
Species Human (GRCh38) Human (GRCh38)
Location 14:22957093-22957115 14:22957117-22957139
Sequence CCGGGAAGGGGAAGGAGCCGAAA TGCACTAGAGGCCGCGACGAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 19, 4: 262} {0: 1, 1: 0, 2: 1, 3: 0, 4: 20}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!