ID: 1114476448_1114476454

View in Genome Browser

Spacer: 8

Left Crispr Right Crispr
Crispr ID 1114476448 1114476454
Species Human (GRCh38) Human (GRCh38)
Location 14:22998552-22998574 14:22998583-22998605
Sequence CCTCAATCACCACCTGCACGCCG GCTGTCACACTCCTCTTCCACGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 105} {0: 1, 1: 0, 2: 0, 3: 12, 4: 162}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!