|
Left Crispr |
Right Crispr |
| Crispr ID |
1114478813 |
1114478817 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
14:23018071-23018093
|
14:23018087-23018109
|
| Sequence |
CCAGTCTGACTGGTGTCCTTATA |
CCTTATAAGAAGAGGGAATTTGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 8, 1: 152, 2: 663, 3: 1499, 4: 2121} |
{0: 2, 1: 100, 2: 425, 3: 893, 4: 1467} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|