ID: 1114483249_1114483261

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 1114483249 1114483261
Species Human (GRCh38) Human (GRCh38)
Location 14:23048048-23048070 14:23048088-23048110
Sequence CCAGCGGCTCCGCGGGGCCGGGG GCCGGAGCCCAGGGAGCTGAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 5, 3: 46, 4: 437} {0: 1, 1: 1, 2: 5, 3: 77, 4: 772}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!