|
Left Crispr |
Right Crispr |
| Crispr ID |
1114501536 |
1114501538 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
14:23172687-23172709
|
14:23172701-23172723
|
| Sequence |
CCGTATCTGGAGACACTTTTGGT |
ACTTTTGGTTGTCACAATGAGGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 1, 1: 2, 2: 42, 3: 78, 4: 209} |
{0: 1, 1: 4, 2: 35, 3: 180, 4: 623} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|