ID: 1114501536_1114501539

View in Genome Browser

Spacer: -6

Left Crispr Right Crispr
Crispr ID 1114501536 1114501539
Species Human (GRCh38) Human (GRCh38)
Location 14:23172687-23172709 14:23172704-23172726
Sequence CCGTATCTGGAGACACTTTTGGT TTTGGTTGTCACAATGAGGGTGG
Strand - +
Off-target summary {0: 1, 1: 2, 2: 42, 3: 78, 4: 209} {0: 1, 1: 4, 2: 33, 3: 169, 4: 478}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!