ID: 1114517695_1114517700

View in Genome Browser

Spacer: 15

Left Crispr Right Crispr
Crispr ID 1114517695 1114517700
Species Human (GRCh38) Human (GRCh38)
Location 14:23310500-23310522 14:23310538-23310560
Sequence CCAGAACGTGGGACCAAATTGGC CAGACTTCTGCTTTTGAGAGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 44} {0: 1, 1: 0, 2: 1, 3: 23, 4: 228}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!