ID: 1114524045_1114524051

View in Genome Browser

Spacer: -10

Left Crispr Right Crispr
Crispr ID 1114524045 1114524051
Species Human (GRCh38) Human (GRCh38)
Location 14:23357162-23357184 14:23357175-23357197
Sequence CCACCCAAGGCCTAAAGGGGGGC AAAGGGGGGCTTTGGCAGGCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 137} {0: 1, 1: 0, 2: 1, 3: 22, 4: 264}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!