ID: 1114529294_1114529297

View in Genome Browser

Spacer: 5

Left Crispr Right Crispr
Crispr ID 1114529294 1114529297
Species Human (GRCh38) Human (GRCh38)
Location 14:23385831-23385853 14:23385859-23385881
Sequence CCTGGCTAGATGTGCTCACTTAG CTGGCTTTTCTAGATGTCCTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 3, 4: 87} {0: 1, 1: 0, 2: 3, 3: 21, 4: 312}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!