ID: 1114538326_1114538328

View in Genome Browser

Spacer: 0

Left Crispr Right Crispr
Crispr ID 1114538326 1114538328
Species Human (GRCh38) Human (GRCh38)
Location 14:23436871-23436893 14:23436894-23436916
Sequence CCTACGAGCACAGAACACAACCG ATGCCATGCTCTTCTAGCAACGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 53} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!