ID: 1114552134_1114552138

View in Genome Browser

Spacer: -9

Left Crispr Right Crispr
Crispr ID 1114552134 1114552138
Species Human (GRCh38) Human (GRCh38)
Location 14:23538786-23538808 14:23538800-23538822
Sequence CCTGGGTAGAGGCAAGGGCTGGG AGGGCTGGGGGCCTCTGTGAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 5, 3: 47, 4: 536} {0: 1, 1: 0, 2: 7, 3: 64, 4: 542}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!