ID: 1114576606_1114576614

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 1114576606 1114576614
Species Human (GRCh38) Human (GRCh38)
Location 14:23719989-23720011 14:23720030-23720052
Sequence CCCTGCTCCATCTGTGGAAAAAT TCCACGGTGCCAAAGAGGTTGGG
Strand - +
Off-target summary {0: 1, 1: 5, 2: 25, 3: 113, 4: 451} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!