ID: 1114578142_1114578144

View in Genome Browser

Spacer: 20

Left Crispr Right Crispr
Crispr ID 1114578142 1114578144
Species Human (GRCh38) Human (GRCh38)
Location 14:23731662-23731684 14:23731705-23731727
Sequence CCTTCTTTCTTCTGCTCATAAAG CTGAGCCCTTTCAAAAGTGCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 36, 4: 651} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!