ID: 1114584266_1114584273

View in Genome Browser

Spacer: 30

Left Crispr Right Crispr
Crispr ID 1114584266 1114584273
Species Human (GRCh38) Human (GRCh38)
Location 14:23795449-23795471 14:23795502-23795524
Sequence CCCGGCTCCTATTCAAGATGGAG TGTTGATATATTATTATTTCTGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 1, 3: 47, 4: 549}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!