|
Left Crispr |
Right Crispr |
| Crispr ID |
1114603885 |
1114603889 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
14:23980060-23980082
|
14:23980094-23980116
|
| Sequence |
CCAATAAAGAAGAAAAGAGAGAA |
GTGCAATAAAAAATGATGGAGGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 88, 1: 62, 2: 53, 3: 509, 4: 9592} |
{0: 2, 1: 2, 2: 82, 3: 2763, 4: 3614} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|