ID: 1114604848_1114604854

View in Genome Browser

Spacer: -10

Left Crispr Right Crispr
Crispr ID 1114604848 1114604854
Species Human (GRCh38) Human (GRCh38)
Location 14:23988443-23988465 14:23988456-23988478
Sequence CCAGCCTCACCTGGTGGACTCCA GTGGACTCCATGGGGACCACAGG
Strand - +
Off-target summary {0: 3, 1: 0, 2: 2, 3: 21, 4: 222} {0: 2, 1: 1, 2: 0, 3: 16, 4: 141}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!