ID: 1114612706_1114612710

View in Genome Browser

Spacer: -2

Left Crispr Right Crispr
Crispr ID 1114612706 1114612710
Species Human (GRCh38) Human (GRCh38)
Location 14:24052776-24052798 14:24052797-24052819
Sequence CCCAGCCTGCTTCCTTCTCGCTA TACCCACCACCCACACATCAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 31, 4: 232} {0: 1, 1: 0, 2: 5, 3: 7, 4: 205}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!