ID: 1114612754_1114612761

View in Genome Browser

Spacer: 25

Left Crispr Right Crispr
Crispr ID 1114612754 1114612761
Species Human (GRCh38) Human (GRCh38)
Location 14:24053047-24053069 14:24053095-24053117
Sequence CCAGCACACGCGCGTGCACACAC TTCTGCCAGCAGATGGGTATGGG
Strand - +
Off-target summary {0: 1, 1: 3, 2: 17, 3: 173, 4: 592} {0: 1, 1: 0, 2: 2, 3: 34, 4: 177}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!