ID: 1114615697_1114615705

View in Genome Browser

Spacer: 28

Left Crispr Right Crispr
Crispr ID 1114615697 1114615705
Species Human (GRCh38) Human (GRCh38)
Location 14:24067157-24067179 14:24067208-24067230
Sequence CCTGCAGTATTAGTCCTTCTCAG CTTTCTGGCCCCATGACCGGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 18, 4: 99} {0: 1, 1: 0, 2: 0, 3: 2, 4: 85}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!