ID: 1114617070_1114617081

View in Genome Browser

Spacer: 26

Left Crispr Right Crispr
Crispr ID 1114617070 1114617081
Species Human (GRCh38) Human (GRCh38)
Location 14:24074038-24074060 14:24074087-24074109
Sequence CCTCCATCCCCAGATTGTGTCAC CTGAAGAATGGGAAGACTGCGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 19, 4: 260} {0: 1, 1: 0, 2: 1, 3: 27, 4: 262}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!