ID: 1114620127_1114620132

View in Genome Browser

Spacer: -2

Left Crispr Right Crispr
Crispr ID 1114620127 1114620132
Species Human (GRCh38) Human (GRCh38)
Location 14:24090827-24090849 14:24090848-24090870
Sequence CCTTGCTCCATCTGCCTAAAGCT CTAGAGAAGAAAGTAATGGTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 203} {0: 1, 1: 1, 2: 2, 3: 20, 4: 263}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!