ID: 1114626981_1114626992

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 1114626981 1114626992
Species Human (GRCh38) Human (GRCh38)
Location 14:24136387-24136409 14:24136427-24136449
Sequence CCACGCGAGTCGGGGGCAGTCGG GAGCACCTGCGCCCCGGGGAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 18} {0: 1, 1: 0, 2: 1, 3: 15, 4: 225}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!