ID: 1114633649_1114633657

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 1114633649 1114633657
Species Human (GRCh38) Human (GRCh38)
Location 14:24175264-24175286 14:24175305-24175327
Sequence CCAAAGTGCTGGGATTACAGACA CTTCTTGCACAAATTGATGAGGG
Strand - +
Off-target summary {0: 4124, 1: 101521, 2: 240356, 3: 245391, 4: 213829} {0: 1, 1: 0, 2: 0, 3: 14, 4: 156}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!