ID: 1114635779_1114635791

View in Genome Browser

Spacer: 11

Left Crispr Right Crispr
Crispr ID 1114635779 1114635791
Species Human (GRCh38) Human (GRCh38)
Location 14:24186044-24186066 14:24186078-24186100
Sequence CCTCCCAGGGTCTAAACGTCGTT GACTAGGCACACTTGGAGGTAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 25} {0: 1, 1: 0, 2: 0, 3: 9, 4: 102}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!