ID: 1114635781_1114635791

View in Genome Browser

Spacer: 8

Left Crispr Right Crispr
Crispr ID 1114635781 1114635791
Species Human (GRCh38) Human (GRCh38)
Location 14:24186047-24186069 14:24186078-24186100
Sequence CCCAGGGTCTAAACGTCGTTGGC GACTAGGCACACTTGGAGGTAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 0, 4: 20} {0: 1, 1: 0, 2: 0, 3: 9, 4: 102}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!