ID: 1114636498_1114636501

View in Genome Browser

Spacer: -6

Left Crispr Right Crispr
Crispr ID 1114636498 1114636501
Species Human (GRCh38) Human (GRCh38)
Location 14:24190039-24190061 14:24190056-24190078
Sequence CCATTTTATTCCACTTTATTCTT ATTCTTTGCCTGGCACAAAGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 22, 3: 159, 4: 1669} {0: 1, 1: 0, 2: 2, 3: 19, 4: 233}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!