ID: 1114649885_1114649890

View in Genome Browser

Spacer: -1

Left Crispr Right Crispr
Crispr ID 1114649885 1114649890
Species Human (GRCh38) Human (GRCh38)
Location 14:24277788-24277810 14:24277810-24277832
Sequence CCTCTGGGAATCTTGGGTGGGGG GTGCTGGATGCTGGCCTTGTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 29, 4: 235} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!