ID: 1114654977_1114654991

View in Genome Browser

Spacer: 14

Left Crispr Right Crispr
Crispr ID 1114654977 1114654991
Species Human (GRCh38) Human (GRCh38)
Location 14:24310612-24310634 14:24310649-24310671
Sequence CCACCCCTGAACGCCCTCTGTGG CTGTAGGCCCAGAAGGATGTCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 19, 4: 174} {0: 1, 1: 0, 2: 2, 3: 19, 4: 181}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!