ID: 1114657347_1114657353

View in Genome Browser

Spacer: -2

Left Crispr Right Crispr
Crispr ID 1114657347 1114657353
Species Human (GRCh38) Human (GRCh38)
Location 14:24324056-24324078 14:24324077-24324099
Sequence CCTCACCAGGCTGGTAATGGCCA CATGGCAAAGACAAGGAGGATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 172} {0: 1, 1: 1, 2: 1, 3: 49, 4: 462}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!