ID: 1114659961_1114659974

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 1114659961 1114659974
Species Human (GRCh38) Human (GRCh38)
Location 14:24337834-24337856 14:24337875-24337897
Sequence CCCAAGCTTATCCTAGATCCAGC TGGAAGGAGGGTCTGTCCTTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 105} {0: 1, 1: 0, 2: 2, 3: 16, 4: 291}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!