ID: 1114670995_1114671005

View in Genome Browser

Spacer: 25

Left Crispr Right Crispr
Crispr ID 1114670995 1114671005
Species Human (GRCh38) Human (GRCh38)
Location 14:24411011-24411033 14:24411059-24411081
Sequence CCCCAGGGCTGGCTCTGAGGGAG GTCCCACGACCCCACAGGCATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 5, 3: 53, 4: 469} {0: 1, 1: 0, 2: 0, 3: 14, 4: 141}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!