ID: 1114670996_1114671005

View in Genome Browser

Spacer: 24

Left Crispr Right Crispr
Crispr ID 1114670996 1114671005
Species Human (GRCh38) Human (GRCh38)
Location 14:24411012-24411034 14:24411059-24411081
Sequence CCCAGGGCTGGCTCTGAGGGAGG GTCCCACGACCCCACAGGCATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 71, 4: 466} {0: 1, 1: 0, 2: 0, 3: 14, 4: 141}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!