ID: 1114673625_1114673630

View in Genome Browser

Spacer: -4

Left Crispr Right Crispr
Crispr ID 1114673625 1114673630
Species Human (GRCh38) Human (GRCh38)
Location 14:24427852-24427874 14:24427871-24427893
Sequence CCGACGCAGGCGCAGAGACACTC ACTCGGTCCCCAGGGTCCAAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 375} {0: 1, 1: 0, 2: 0, 3: 13, 4: 114}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!