ID: 1114674729_1114674747

View in Genome Browser

Spacer: 24

Left Crispr Right Crispr
Crispr ID 1114674729 1114674747
Species Human (GRCh38) Human (GRCh38)
Location 14:24432339-24432361 14:24432386-24432408
Sequence CCTCCACCTGCACCGGAACCCCC CTGCGGAGACCGGGGAGACGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 28, 4: 382} {0: 1, 1: 0, 2: 1, 3: 19, 4: 174}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!