ID: 1114683316_1114683323

View in Genome Browser

Spacer: 4

Left Crispr Right Crispr
Crispr ID 1114683316 1114683323
Species Human (GRCh38) Human (GRCh38)
Location 14:24505617-24505639 14:24505644-24505666
Sequence CCTGGGCCACCCCAGCACACAGA GGCCCCCAGAGTCTCCCTGTAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 5, 3: 43, 4: 420} {0: 1, 1: 0, 2: 5, 3: 28, 4: 210}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!