ID: 1114690065_1114690074

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 1114690065 1114690074
Species Human (GRCh38) Human (GRCh38)
Location 14:24573324-24573346 14:24573339-24573361
Sequence CCCTTGCCCCTTTTGCCATATGT CCATATGTGGACACAGGGAGAGG
Strand - +
Off-target summary No data {0: 1, 1: 1, 2: 15, 3: 206, 4: 1372}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!