ID: 1114693472_1114693479

View in Genome Browser

Spacer: -2

Left Crispr Right Crispr
Crispr ID 1114693472 1114693479
Species Human (GRCh38) Human (GRCh38)
Location 14:24606529-24606551 14:24606550-24606572
Sequence CCCACCCCTTGGGGATTCTTGCC CCTCTGTCCCAGAGATGGTCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 101} {0: 1, 1: 0, 2: 4, 3: 17, 4: 199}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!